Affinity DataKi: 3.10nMAssay Description:Binding affinity of SARS-Cov-2 M pro expressed in Escherichia coli cells BL21(DE3) assessed as inhibition constant preincubated for 30 mins followed ...More data for this Ligand-Target Pair
Affinity DataKi: 174nMAssay Description:Binding affinity of SARS-Cov-2 M pro expressed in Escherichia coli cells BL21(DE3) assessed as inhibition constant preincubated for 30 mins followed ...More data for this Ligand-Target Pair
Affinity DataIC50: 2.40nMAssay Description:Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'...More data for this Ligand-Target Pair
Affinity DataIC50: 3nMAssay Description:Inhibition of RNA-dependent DNA polymerase activity of wild type Human immunodeficiency virus 1 reverse transcriptaseMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 12nMAssay Description:Inhibition of HIV1 reverse transcriptase-associated RNA-dependent DNA polymerase activity after 30 minsMore data for this Ligand-Target Pair
Affinity DataIC50: 18nMAssay Description:Binding affinity to recombinant HIV-1 integrase catalytic core domain expressed in Escherichia coli assessed as inhibition of interaction with LEDFG/...More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 20nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 20nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 20nMpH: 8.1 T: 2°CAssay Description:RNA-dependent DNA polymerase (RDDP) activity was measured as described[J. Microbiol. 2015, 53:288-293] in Tris·HCl buffer (25 mL, 60 mm, pH 8.1) con...More data for this Ligand-Target Pair
Affinity DataIC50: 21nMAssay Description:Inhibition of FITC-geldanamycin binding to recombinant human HSP90alpha expressed in Escherichia coli by fluorescence anisotropy methodMore data for this Ligand-Target Pair
Affinity DataIC50: 22nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 24nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 25nMpH: 8.1Assay Description:The RNA-dependent DNA polymerase (RDDP) activity associated with HIV-1 RT was measured by use of the Invitrogen EnzCheck Reverse Transcriptase Assay ...More data for this Ligand-Target Pair
Affinity DataIC50: 26nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 30nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£
Curated by ChEMBL
"Sapienza" Universit£
Curated by ChEMBL
Affinity DataIC50: 35nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 40nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 42nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 43nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 46nMAssay Description:Inhibition of SARS-CoV-2 nsp13 helicase-associated activity using 5'- AGT CTT CTC CTG GTG CTC GAA CAG TGA CCy3-3', 5'- BHQ-2-GTC ACT GTT CGA GCA CCA ...More data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 52nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 53nMAssay Description:Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'...More data for this Ligand-Target Pair
Affinity DataIC50: 57nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 58nMAssay Description:Inhibition of LEDGF/p75-dependent full length HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells preincubated for 1 hr further incubated f...More data for this Ligand-Target Pair
Affinity DataIC50: 59nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 60nMAssay Description:Binding affinity to recombinant HIV-1 integrase catalytic core domain expressed in Escherichia coli assessed as inhibition of interaction with LEDFG/...More data for this Ligand-Target Pair
Affinity DataIC50: 63nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 66nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Inhibition of HIV-1 HXB2 integrase using 32P-labelled oligonucleotide as substrate after 1 hr by phosphorimager analysisMore data for this Ligand-Target Pair
Affinity DataIC50: 90nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 90nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 110nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 110nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 140nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 140nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 140nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 150nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 150nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 160nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair