Compile Data Set for Download or QSAR
maximum 50k data
Found 122 with Last Name = 'grandi' and Initial = 'n'
TargetIntegrase(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM25351(N-[2-(4-{[(4-fluorophenyl)methyl]carbamoyl}-5-hydr...)
Affinity DataIC50:  19nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
In DepthDetails PubMedDrugBank

TargetGag-Pol polyprotein(Human immunodeficiency virus type 1 group M subtyp...)
University of Siena

LigandPNGBDBM2483((4S)-6-chloro-4-(2-cyclopropylethynyl)-4-(trifluor...)
Affinity DataIC50:  20nMpH: 8.1 T: 2°CAssay Description:RNA-dependent DNA polymerase (RDDP) activity was measured as described[J. Microbiol. 2015, 53:288-293] in Tris·HCl buffer (25 mL, 60 mm, pH 8.1) con...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM2483((4S)-6-chloro-4-(2-cyclopropylethynyl)-4-(trifluor...)
Affinity DataIC50:  35nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
TargetIntegrase(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587990(CHEMBL5182942)
Affinity DataIC50:  50nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM33411(β-Thujaplicinol | hydroxytropolone, 3)
Affinity DataIC50:  190nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540702(CHEMBL4641618)
Affinity DataIC50:  270nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetIntegrase(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587966(CHEMBL5188823)
Affinity DataIC50:  410nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587988(CHEMBL5172754)
Affinity DataIC50:  1.49E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587969(CHEMBL5173288)
Affinity DataIC50:  1.51E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540705(CHEMBL4641010)
Affinity DataIC50:  1.73E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587990(CHEMBL5182942)
Affinity DataIC50:  1.88E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587968(CHEMBL5198940)
Affinity DataIC50:  2.00E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587974(CHEMBL5185855)
Affinity DataIC50:  2.20E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540703(CHEMBL4639414)
Affinity DataIC50:  2.38E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540701(CHEMBL4648383)
Affinity DataIC50:  3.21E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetIntegrase(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587968(CHEMBL5198940)
Affinity DataIC50:  3.25E+3nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetIntegrase(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587965(CHEMBL5176128)
Affinity DataIC50:  3.38E+3nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540696(CHEMBL4643229)
Affinity DataIC50:  4.15E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540704(CHEMBL4634514)
Affinity DataIC50:  4.50E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587971(CHEMBL5183730)
Affinity DataIC50:  5.10E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540692(CHEMBL4649730)
Affinity DataIC50:  5.40E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540695(CHEMBL4638007)
Affinity DataIC50:  5.50E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587967(CHEMBL5197780)
Affinity DataIC50:  5.60E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540708(CHEMBL4640609)
Affinity DataIC50:  5.80E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587965(CHEMBL5176128)
Affinity DataIC50:  5.90E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540698(CHEMBL4644576)
Affinity DataIC50:  6.80E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540710(CHEMBL4643404)
Affinity DataIC50:  7.30E+3nMAssay Description:Inhibition of RNase H activity of recombinant HIV-1 reverse transcriptase p66/p51 expressed in Escherichia coli M15 using 5'-[gamma32P]ATP-labeled-tC...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587973(CHEMBL5198310)
Affinity DataIC50:  7.47E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587974(CHEMBL5185855)
Affinity DataIC50:  7.48E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetGag-Pol polyprotein(Human immunodeficiency virus type 1 group M subtyp...)
University of Siena

LigandPNGBDBM189342(RDS1759)
Affinity DataIC50:  7.50E+3nMpH: 7.8 T: 2°CAssay Description:HIV RT-associated RNase H activity was measured as previously described.[J. Med. Chem. 2014, 57:3223-3234] Briefly, the reaction mixture comprised ...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540699(CHEMBL4648093)
Affinity DataIC50:  7.90E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587991(CHEMBL5174596)
Affinity DataIC50:  8.00E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540697(CHEMBL4633074)
Affinity DataIC50:  8.10E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587967(CHEMBL5197780)
Affinity DataIC50:  8.19E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587972(CHEMBL5202973)
Affinity DataIC50:  8.27E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540694(CHEMBL4640576)
Affinity DataIC50:  8.50E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540709(CHEMBL4642283)
Affinity DataIC50:  9.20E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540679(CHEMBL4642836)
Affinity DataIC50:  9.40E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540677(CHEMBL4647376)
Affinity DataIC50:  9.40E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetIntegrase(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587989(CHEMBL5191403)
Affinity DataIC50:  9.45E+3nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50076167(CHEMBL3415832)
Affinity DataIC50:  1.00E+4nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587977(CHEMBL5194402)
Affinity DataIC50:  1.10E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587969(CHEMBL5173288)
Affinity DataIC50:  1.14E+4nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587973(CHEMBL5198310)
Affinity DataIC50:  1.16E+4nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587971(CHEMBL5183730)
Affinity DataIC50:  1.35E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540687(CHEMBL4649140)
Affinity DataIC50:  1.37E+4nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50540672(CHEMBL4642985)
Affinity DataIC50:  1.43E+4nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587992(CHEMBL5187082)
Affinity DataIC50:  1.53E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587964(CHEMBL5187446)
Affinity DataIC50:  1.54E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandPNGBDBM50587958(CHEMBL5207303)
Affinity DataIC50:  1.63E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails PubMed
Displayed 1 to 50 (of 122 total ) | Next | Last >>
Jump to: