| Assay Method Information | |
| | Test Method of EC50 of Anti HBV |
| Description: | 8000 HepG 2.2.15 cells per well were seeded into a 96-well plate, the plate was cultured at 37° C. and 5% CO2 for 3 days till the cells grew to full wells. Old liquid medium can be removed and replaced with new medium (200 μL) on day 0.Formulating the compound and treating the cells in the experiment of anti virus: the compound was dissolved in DMSO to a concentration of 30 mM, and then the compound solution was diluted with DMSO to a concentration of 800M, and then eight dilutions at 4 fold were performed, the highest concentration is 800 μM. The serial diluted compound was added to the above plate at 1 μL per well, the highest final concentration in the experiment is 4 μM (200 fold dilution). TDF (tenofovir dipiroxil fumarate, Selleck, Cat S1400) has a highest concentration of 4 μM as a positive control. 1 μL of DMSO was added in to the positive control well at a final concentration of 0.5%, TDF was added in to the positive control well at a final concentration of 1 μM.Detection of Viral Genomic DNA by qPCRPrimer: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. Copies of virus can be calculated using a standard curve plotted by using plasmid containing HBV genome and using SYBR Premix Ex Taq II Takara DRR081S kit and 1 μL cell culture supernatant as a template. EC50 values of the compound on viral replication were calculated by a four parametric nonlinear regression model using Graphpad Prism 5 software to manage concentration viral copy number. |
| Affinity data for this assay | |
|---|---|
| If you find an error in this entry please send us an E-mail | |