| Assay Method Information | |
| | Cell-Based HCV Replicon Assay |
| Description: | To measure cell-based anti-HCV activity of selected compounds of the present invention, replicon cells were seeded at 5000 cells/well in 96-well collagen I-coated Nunc plates in the presence of the test compound. Various concentrations of test compound, typically in 10 serial 2-fold dilutions, were added to the assay mixture, with the starting concentration ranging from 250 uM to 1 uM. The final concentration of dimethylsulfoxide was 0.5% fetal bovine serum was 5%, in the assay media. Cells were harvested on day 3 by the addition of 1x cell lysis buffer (Ambion cat #8721).The replicon RNA level was measured using real time PCR (Taqman assay). The amplicon was located in 5B. The PCR primers were: 5B.2F, ATGGACAGGCGCCCTGA (SEQ ID. NO. 1); 5B.2R, TTGATGGGCAGCTTGGTTTC (SEQ ID. NO. 2); the probe sequence was FAM-labeled CACGCCATGCGCTGCGG (SEQ ID. NO. 3). GAPDH RNA was used as endogenous control and was amplified in the same reaction as NS5B (multiplex PCR) using primers and VIC-labeled probe recommended by the manufacturer (PE Applied Biosystem). The real-time RT-PCR reactions were run on ABI PRISM 7900HT Sequence Detection System using the following program: 48° C. for 30 minutes, 95° C. for 10 minutes, 40 cycles of 95° C. for 15 sec, 60° C. for 1 minute. The ΔCT values (CT5B-CTGAPDH) were plotted against the concentration of test compound and fitted to the sigmoid dose-response model using XLfit4 (MDL). EC50 was defined as the concentration of inhibitor necessary to achieve ΔCT=1 over the projected baseline; EC90 the concentration necessary to achieve ΔCT=3.2 over the baseline. Alternatively, to quantitate the absolute amount of replicon RNA, a standard curve was established by including serially diluted T7 transcripts of replicon RNA in the Taqman assay. All Taqman reagents were from petroleum ether Applied Biosystems. Such an assay procedure was described in detail in e.g. Malcolm et al., Antimicrobial Agents and Chemotherapy 50: 1013-1020 (2006). |
| Affinity data for this assay | |
|---|---|
| If you find an error in this entry please send us an E-mail | |