Report error Found 599 with Last Name = 'esposito' and Initial = 'f'
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataEC50: 120nMAssay Description:anti-cytopathic effect in a Vero-E6 cell line.More data for this Ligand-Target Pair
Affinity DataKd: 1.5nMAssay Description:Inhibition of FITC-geldanamycin binding to recombinant human HSP90alpha expressed in Escherichia coli by fluorescence anisotropy methodMore data for this Ligand-Target Pair
Affinity DataKd: 10nMAssay Description:Inhibition of FITC-geldanamycin binding to recombinant human N-terminal His6-tagged TRAP1 (60 to 704 residues) expressed in Escherichia coli BL21-Cod...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 0.220nMAssay Description:Inhibition of SARS-CoV-2 3CL protease expressed in Escherichia coli BL21(DE3) cells using DABCYL-KTSAVLQSGFRKM-EDANS as substrate preincubated for 30...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 0.240nMAssay Description:Inhibition of SARS-CoV-2 3CL protease expressed in Escherichia coli BL21(DE3) cells using DABCYL-KTSAVLQSGFRKM-EDANS as substrate preincubated for 30...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 0.470nMAssay Description:Inhibition of SARS-CoV-2 3CL protease expressed in Escherichia coli BL21(DE3) cells using DABCYL-KTSAVLQSGFRKM-EDANS as substrate preincubated for 30...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 0.700nMAssay Description:Inhibition of SARS-CoV-2 3CL protease expressed in Escherichia coli BL21(DE3) cells using DABCYL-KTSAVLQSGFRKM-EDANS as substrate preincubated for 30...More data for this Ligand-Target Pair
Affinity DataIC50: 2.40nMAssay Description:Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 2.5nMAssay Description:Inhibition of SARS-CoV-2 3CL protease expressed in Escherichia coli BL21(DE3) cells using DABCYL-KTSAVLQSGFRKM-EDANS as substrate preincubated for 30...More data for this Ligand-Target Pair
TargetReverse transcriptase(Human immunodeficiency virus type 1)
Magna Graecia University of Catanzaro
Curated by ChEMBL
Magna Graecia University of Catanzaro
Curated by ChEMBL
Affinity DataIC50: 3nMAssay Description:Inhibition of RNA-dependent DNA polymerase activity of wild type Human immunodeficiency virus 1 reverse transcriptaseMore data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 5nMAssay Description:Inhibition of SARS-CoV-2 3CL protease expressed in Escherichia coli BL21(DE3) cells using DABCYL-KTSAVLQSGFRKM-EDANS as substrate preincubated for 30...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 5.30nMAssay Description:Inhibition of SARS-CoV-2 3CL protease expressed in Escherichia coli BL21(DE3) cells using DABCYL-KTSAVLQSGFRKM-EDANS as substrate preincubated for 30...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 6.20nMAssay Description:Inhibition of SARS-CoV-2 3CL protease expressed in Escherichia coli BL21(DE3) cells using DABCYL-KTSAVLQSGFRKM-EDANS as substrate preincubated for 30...More data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 7nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 10nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 10nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 10nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
TargetReverse transcriptase(Human immunodeficiency virus type 1)
Magna Graecia University of Catanzaro
Curated by ChEMBL
Magna Graecia University of Catanzaro
Curated by ChEMBL
Affinity DataIC50: 12nMAssay Description:Inhibition of HIV1 reverse transcriptase-associated RNA-dependent DNA polymerase activity after 30 minsMore data for this Ligand-Target Pair
Affinity DataIC50: 18nMAssay Description:Binding affinity to recombinant HIV-1 integrase catalytic core domain expressed in Escherichia coli assessed as inhibition of interaction with LEDFG/...More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 20nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 20nMpH: 8.1 T: 2°CAssay Description:RNA-dependent DNA polymerase (RDDP) activity was measured as described[J. Microbiol. 2015, 53:288-293] in Tris HCl buffer (25 mL, 60 mm, pH 8.1) cont...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 20nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 21nMAssay Description:Inhibition of FITC-geldanamycin binding to recombinant human HSP90alpha expressed in Escherichia coli by fluorescence anisotropy methodMore data for this Ligand-Target Pair
Affinity DataIC50: 22nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 24nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 25nMpH: 8.1Assay Description:The RNA-dependent DNA polymerase (RDDP) activity associated with HIV-1 RT was measured by use of the Invitrogen EnzCheck Reverse Transcriptase Assay ...More data for this Ligand-Target Pair
Affinity DataIC50: 26nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 30nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£
Curated by ChEMBL
"Sapienza" Universit£
Curated by ChEMBL
Affinity DataIC50: 35nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 40nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 42nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 43nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 46nMAssay Description:Inhibition of SARS-CoV-2 nsp13 helicase-associated activity using 5'- AGT CTT CTC CTG GTG CTC GAA CAG TGA CCy3-3', 5'- BHQ-2-GTC ACT GTT CGA GCA CCA ...More data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 52nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 53nMAssay Description:Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'...More data for this Ligand-Target Pair
Affinity DataIC50: 57nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 58nMAssay Description:Inhibition of LEDGF/p75-dependent full length HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells preincubated for 1 hr further incubated f...More data for this Ligand-Target Pair
Affinity DataIC50: 59nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair
Affinity DataIC50: 60nMAssay Description:Binding affinity to recombinant HIV-1 integrase catalytic core domain expressed in Escherichia coli assessed as inhibition of interaction with LEDFG/...More data for this Ligand-Target Pair
Affinity DataIC50: 63nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
Affinity DataIC50: 66nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by gel-based assayMore data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 80nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 80nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
TargetReplicase polyprotein 1ab(2019-nCoV)
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Fraunhofer Institute For Translational Medicine and Pharmacology (Itmp) and Fraunhofer Cluster of Excellence For Immune Mediated Diseases (Cimd
Affinity DataIC50: 80nMAssay Description:Primary assay principle based on quenched FRET peptide substrate of SARS-CoV-2 3CL-Pro (lhs). Inhibiting compounds reduce fluorescence signal relativ...More data for this Ligand-Target Pair
Affinity DataIC50: 80nMAssay Description:Inhibition of HIV-1 HXB2 integrase using 32P-labelled oligonucleotide as substrate after 1 hr by phosphorimager analysisMore data for this Ligand-Target Pair
Affinity DataIC50: 90nMAssay Description:Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by el...More data for this Ligand-Target Pair









3D Structure (crystal)
























