Compile Data Set for Download or QSAR
Report error Found 108 Enz. Inhib. hit(s) with Target = 'Tripartite terminase subunit 3'
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633918BDBM50633918(CHEMBL5435292)
Affinity DataIC50: 100nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633919BDBM50633919(CHEMBL5394678)
Affinity DataIC50: 220nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633917BDBM50633917(CHEMBL5400428)
Affinity DataIC50: 300nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50157832BDBM50157832(3-Hydroxy-4a,7a-dihydro-1H-thieno[2,3-d]pyrimidine...)
Affinity DataIC50: 400nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633914BDBM50633914(CHEMBL5426420)
Affinity DataIC50: 480nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604814BDBM50604814(CHEMBL5185038)
Affinity DataIC50: 540nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604832BDBM50604832(CHEMBL5205946)
Affinity DataIC50: 590nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50157834BDBM50157834(3-Hydroxy-6-phenyl-1H-thieno[3,2-d]pyrimidine-2,4-...)
Affinity DataIC50: 600nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604819BDBM50604819(CHEMBL204900)
Affinity DataIC50: 620nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604819BDBM50604819(CHEMBL204900)
Affinity DataIC50: 620nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604829BDBM50604829(CHEMBL551212)
Affinity DataIC50: 670nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633915BDBM50633915(CHEMBL5422734)
Affinity DataIC50: 680nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50121880BDBM50121880(CHEMBL216874)
Affinity DataIC50: 700nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604822BDBM50604822(CHEMBL1085364)
Affinity DataIC50: 740nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533378BDBM50533378(CHEMBL4440667)
Affinity DataIC50: 740nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604823BDBM50604823(CHEMBL5203198)
Affinity DataIC50: 760nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604817BDBM50604817(CHEMBL5203310)
Affinity DataIC50: 780nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50157854BDBM50157854(5,6-Dibutyl-3-hydroxy-1H-thieno[2,3-d]pyrimidine-2...)
Affinity DataIC50: 790nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604836BDBM50604836(CHEMBL5190900)
Affinity DataIC50: 790nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604813BDBM50604813(CHEMBL5171144)
Affinity DataIC50: 860nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604827BDBM50604827(CHEMBL5196576)
Affinity DataIC50: 870nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50121868BDBM50121868(CHEMBL187010)
Affinity DataIC50: 880nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604820BDBM50604820(CHEMBL5184216)
Affinity DataIC50: 920nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633920BDBM50633920(CHEMBL5399934)
Affinity DataIC50: 940nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604838BDBM50604838(CHEMBL5172238)
Affinity DataIC50: 1.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604838BDBM50604838(CHEMBL5172238)
Affinity DataIC50: 1.00E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633916BDBM50633916(CHEMBL5406945)
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533405BDBM50533405(CHEMBL4550191)
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50121870BDBM50121870(CHEMBL3617204)
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50460242BDBM50460242(CHEMBL4228948)
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50468792BDBM50468792(CHEMBL4280869)
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50153250BDBM50153250(5,6-Dihydroxy-2-thiophen-2-yl-pyrimidine-4-carboxy...)
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50476511BDBM50476511(CHEMBL232444)
Affinity DataIC50: 1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604821BDBM50604821(CHEMBL5208893)
Affinity DataIC50: 1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604824BDBM50604824(CHEMBL5209461)
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50183501BDBM50183501(5,6-dihydroxy-2-(3-methyl-2-thienyl)pyrimidine-4-c...)
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633913BDBM50633913(CHEMBL5418937)
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50476539BDBM50476539(CHEMBL437708)
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604818BDBM50604818(CHEMBL5188107)
Affinity DataIC50: 1.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50278490BDBM50278490(CHEMBL4161705)
Affinity DataIC50: 1.60E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604830BDBM50604830(CHEMBL5201304)
Affinity DataIC50: 1.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604834BDBM50604834(CHEMBL5208229)
Affinity DataIC50: 1.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633921BDBM50633921(CHEMBL5416503)
Affinity DataIC50: 1.80E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50468804BDBM50468804(CHEMBL4284648)
Affinity DataIC50: 1.90E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
8/21/2022
Entry Details Article
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50476518BDBM50476518(CHEMBL277754)
Affinity DataIC50: 1.90E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604812BDBM50604812(CHEMBL4174171)
Affinity DataIC50: 2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604828BDBM50604828(CHEMBL5182790)
Affinity DataIC50: 2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533401BDBM50533401(CHEMBL4445181)
Affinity DataIC50: 2.20E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533377BDBM50533377(CHEMBL4475877)
Affinity DataIC50: 2.30E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533377BDBM50533377(CHEMBL4475877)
Affinity DataIC50: 2.30E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using dsDNA substrate preincubated for 15 mins followed by substrate addition for 1 hr by ELISAMore data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
Displayed 1 to 50 (of 108 total ) | Next | Last >>
Jump to: