Affinity DataIC50: 15nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: 19nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 20nMpH: 8.0 T: 2°CAssay Description:The IC50 of reverse transcriptase is the concentration that inhibits 50% of recombinant HIV-1 RT RNA-directed DNA polymerase activity in vitro.More data for this Ligand-Target Pair
Affinity DataIC50: 30nMpH: 8.0 T: 2°CAssay Description:The IC50 of reverse transcriptase is the concentration that inhibits 50% of recombinant HIV-1 RT RNA-directed DNA polymerase activity in vitro.More data for this Ligand-Target Pair
Affinity DataIC50: 30nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: 35nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 50nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 100nMpH: 8.0 T: 2°CAssay Description:The IC50 of reverse transcriptase is the concentration that inhibits 50% of recombinant HIV-1 RT RNA-directed DNA polymerase activity in vitro.More data for this Ligand-Target Pair
Affinity DataIC50: 100nMpH: 8.0 T: 2°CAssay Description:The IC50 of reverse transcriptase is the concentration that inhibits 50% of recombinant HIV-1 RT RNA-directed DNA polymerase activity in vitro.More data for this Ligand-Target Pair
Affinity DataIC50: 100nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: 190nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: 200nMpH: 8.0 T: 2°CAssay Description:The IC50 of reverse transcriptase is the concentration that inhibits 50% of recombinant HIV-1 RT RNA-directed DNA polymerase activity in vitro.More data for this Ligand-Target Pair
Affinity DataIC50: 200nMpH: 8.0 T: 2°CAssay Description:The IC50 of reverse transcriptase is the concentration that inhibits 50% of recombinant HIV-1 RT RNA-directed DNA polymerase activity in vitro.More data for this Ligand-Target Pair
Affinity DataIC50: 270nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 300nMpH: 8.0 T: 2°CAssay Description:The IC50 of reverse transcriptase is the concentration that inhibits 50% of recombinant HIV-1 RT RNA-directed DNA polymerase activity in vitro.More data for this Ligand-Target Pair
Affinity DataIC50: 400nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: 400nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: 410nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 600nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: 1.49E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: 1.51E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: 1.73E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 1.88E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 2.20E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 2.38E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 3.21E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 3.25E+3nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: 3.38E+3nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
Affinity DataIC50: >4.00E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: >4.00E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: >4.00E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: 4.15E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 4.50E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 5.10E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 5.40E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 5.50E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 5.60E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
Affinity DataIC50: 5.80E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 5.90E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: >6.00E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase(RT)More data for this Ligand-Target Pair
Affinity DataIC50: 6.80E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 7.30E+3nMAssay Description:Inhibition of RNase H activity of recombinant HIV-1 reverse transcriptase p66/p51 expressed in Escherichia coli M15 using 5'-[gamma32P]ATP-labeled-tC...More data for this Ligand-Target Pair
Affinity DataIC50: 7.47E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: 7.48E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: 7.90E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 8.00E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: 8.10E+3nMAssay Description:Inhibition of RNase H activity of recombinant His-tagged HIV-1 group M subtype B reverse transcriptase p66/p51 expressed in Escherichia coli M15 usin...More data for this Ligand-Target Pair
Affinity DataIC50: 8.19E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
Affinity DataIC50: 8.27E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair