Compile Data Set for Download or QSAR
Report error Found 65 Enz. Inhib. hit(s) with all data for entry = 50015637
TargetIntegrase(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 25351BDBM25351(N-[2-(4-{[(4-fluorophenyl)methyl]carbamoyl}-5-hydr...)
Affinity DataIC50: 19nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 2483BDBM2483(Sustiva | DMP-266 | (4S)-6-chloro-4-(2-cyclopropyl...)
Affinity DataIC50: 35nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMedPDB3D3D Structure (crystal)
TargetIntegrase(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587990BDBM50587990(CHEMBL5182942)
Affinity DataIC50: 50nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 33411BDBM33411(hydroxytropolone, 3 | β-Thujaplicinol)
Affinity DataIC50: 190nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMedPDB3D3D Structure (crystal)
TargetIntegrase(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587966BDBM50587966(CHEMBL5188823)
Affinity DataIC50: 410nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587988BDBM50587988(CHEMBL5172754)
Affinity DataIC50: 1.49E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587969BDBM50587969(CHEMBL5173288)
Affinity DataIC50: 1.51E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587990BDBM50587990(CHEMBL5182942)
Affinity DataIC50: 1.88E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587968BDBM50587968(CHEMBL5198940)
Affinity DataIC50: 2.00E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587974BDBM50587974(CHEMBL5185855)
Affinity DataIC50: 2.20E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587968BDBM50587968(CHEMBL5198940)
Affinity DataIC50: 3.25E+3nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587965BDBM50587965(CHEMBL5176128)
Affinity DataIC50: 3.38E+3nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587971BDBM50587971(CHEMBL5183730)
Affinity DataIC50: 5.10E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587967BDBM50587967(CHEMBL5197780)
Affinity DataIC50: 5.60E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587965BDBM50587965(CHEMBL5176128)
Affinity DataIC50: 5.90E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587973BDBM50587973(CHEMBL5198310)
Affinity DataIC50: 7.47E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587974BDBM50587974(CHEMBL5185855)
Affinity DataIC50: 7.48E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587991BDBM50587991(CHEMBL5174596)
Affinity DataIC50: 8.00E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587967BDBM50587967(CHEMBL5197780)
Affinity DataIC50: 8.19E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587972BDBM50587972(CHEMBL5202973)
Affinity DataIC50: 8.27E+3nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587989BDBM50587989(CHEMBL5191403)
Affinity DataIC50: 9.45E+3nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587977BDBM50587977(CHEMBL5194402)
Affinity DataIC50: 1.10E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587969BDBM50587969(CHEMBL5173288)
Affinity DataIC50: 1.14E+4nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587973BDBM50587973(CHEMBL5198310)
Affinity DataIC50: 1.16E+4nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587971BDBM50587971(CHEMBL5183730)
Affinity DataIC50: 1.35E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587992BDBM50587992(CHEMBL5187082)
Affinity DataIC50: 1.53E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587964BDBM50587964(CHEMBL5187446)
Affinity DataIC50: 1.54E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587958BDBM50587958(CHEMBL5207303)
Affinity DataIC50: 1.63E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587987BDBM50587987(CHEMBL5191482)
Affinity DataIC50: 1.96E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587990BDBM50587990(CHEMBL5182942)
Affinity DataIC50: 2.40E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587989BDBM50587989(CHEMBL5191403)
Affinity DataIC50: 2.41E+4nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587985BDBM50587985(CHEMBL5184868)
Affinity DataIC50: 2.84E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587968BDBM50587968(CHEMBL5198940)
Affinity DataIC50: 2.95E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587970BDBM50587970(CHEMBL5172266)
Affinity DataIC50: 3.03E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587963BDBM50587963(CHEMBL5171239)
Affinity DataIC50: 3.20E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587966BDBM50587966(CHEMBL5188823)
Affinity DataIC50: 3.40E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587989BDBM50587989(CHEMBL5191403)
Affinity DataIC50: 3.72E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587966BDBM50587966(CHEMBL5188823)
Affinity DataIC50: 3.85E+4nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587982BDBM50587982(CHEMBL5192134)
Affinity DataIC50: 4.55E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587978BDBM50587978(CHEMBL5175570)
Affinity DataIC50: 4.78E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587986BDBM50587986(CHEMBL5179284)
Affinity DataIC50: 5.53E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587959BDBM50587959(CHEMBL3309770)
Affinity DataIC50: 5.60E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587976BDBM50587976(CHEMBL5201776)
Affinity DataIC50: 5.90E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587961BDBM50587961(CHEMBL5185881)
Affinity DataIC50: 7.40E+4nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50542324BDBM50542324(CHEMBL4648347)
Affinity DataIC50: 1.00E+5nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587994BDBM50587994(CHEMBL5207685)
Affinity DataIC50: 1.00E+5nMAssay Description:Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587957BDBM50587957(CHEMBL5180442)
Affinity DataIC50: 1.00E+5nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587956BDBM50587956(CHEMBL5173434)
Affinity DataIC50: 1.00E+5nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587960BDBM50587960(CHEMBL5172028)
Affinity DataIC50: 1.00E+5nMAssay Description:Inhibition of recombinant His-tagged wild-type HIV-1 group M subtype B BH10 reverse transcriptase-associated RNase H activity harboring p66/p51 hetro...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
"Sapienza" Universit£

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50587965BDBM50587965(CHEMBL5176128)
Affinity DataIC50: 1.00E+5nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymerase activity using poly(A)-oligo(dT) as template/primer incubated for 3...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/18/2023
Entry Details
PubMed
Displayed 1 to 50 (of 65 total ) | Next | Last >>
Jump to: