Report error Found 45 Enz. Inhib. hit(s) with all data for entry = 50017766
Affinity DataIC50: 15nMAssay Description:Inhibition of recombinant HIV-1 integrase strand transfer activity by enzymatic assayMore data for this Ligand-Target Pair
Affinity DataIC50: 85nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by enzymatic assayMore data for this Ligand-Target Pair
Affinity DataIC50: 540nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 590nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 620nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 670nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 700nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 740nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 760nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 780nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 790nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 860nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 870nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 880nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 920nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 1.90E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 2.30E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using dsDNA substrate preincubated for 15 mins followed by substrate addition for 1 hr by ELISAMore data for this Ligand-Target Pair
Affinity DataIC50: 2.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.50E+3nMAssay Description:Inhibition of recombinant p66/p51 HIV-1 RNase H using 6-FAM-labeld DNA substrate preincubated for 2 mins by fluorescence based assayMore data for this Ligand-Target Pair
TargetRNA-directed RNA polymerase(Hepatitis C virus genotype 1b (isolate Con1) (HCV))
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.60E+3nMAssay Description:Inhibition of deltaC55 truncated Hepatitis C virus NS5B expressed in Escherichia coli using poly(rA)/oligo(rU) as template/primer incubated for 20 mi...More data for this Ligand-Target Pair
Affinity DataIC50: 2.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 2.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 3.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 3.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 3.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 4.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcac ssDNA as substr...More data for this Ligand-Target Pair
Affinity DataIC50: 4.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 4.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 5.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 5.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
Affinity DataIC50: 6.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-CMore data for this Ligand-Target Pair








































