Compile Data Set for Download or QSAR
Report error Found 45 Enz. Inhib. hit(s) with all data for entry = 50017766
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 25351BDBM25351(N-[2-(4-{[(4-fluorophenyl)methyl]carbamoyl}-5-hydr...)
Affinity DataIC50: 15nMAssay Description:Inhibition of recombinant HIV-1 integrase strand transfer activity by enzymatic assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50476539BDBM50476539(CHEMBL437708)
Affinity DataIC50: 85nMAssay Description:Inhibition of HIV-1 integrase strand transfer activity by enzymatic assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604814BDBM50604814(CHEMBL5185038)
Affinity DataIC50: 540nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604832BDBM50604832(CHEMBL5205946)
Affinity DataIC50: 590nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604819BDBM50604819(CHEMBL204900)
Affinity DataIC50: 620nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604829BDBM50604829(CHEMBL551212)
Affinity DataIC50: 670nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50121880BDBM50121880(CHEMBL216874)
Affinity DataIC50: 700nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604822BDBM50604822(CHEMBL1085364)
Affinity DataIC50: 740nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604823BDBM50604823(CHEMBL5203198)
Affinity DataIC50: 760nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604817BDBM50604817(CHEMBL5203310)
Affinity DataIC50: 780nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604836BDBM50604836(CHEMBL5190900)
Affinity DataIC50: 790nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604813BDBM50604813(CHEMBL5171144)
Affinity DataIC50: 860nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604827BDBM50604827(CHEMBL5196576)
Affinity DataIC50: 870nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50121868BDBM50121868(CHEMBL187010)
Affinity DataIC50: 880nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604820BDBM50604820(CHEMBL5184216)
Affinity DataIC50: 920nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604838BDBM50604838(CHEMBL5172238)
Affinity DataIC50: 1.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50121870BDBM50121870(CHEMBL3617204)
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50460242BDBM50460242(CHEMBL4228948)
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50153250BDBM50153250(5,6-Dihydroxy-2-thiophen-2-yl-pyrimidine-4-carboxy...)
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50476511BDBM50476511(CHEMBL232444)
Affinity DataIC50: 1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604821BDBM50604821(CHEMBL5208893)
Affinity DataIC50: 1.30E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604824BDBM50604824(CHEMBL5209461)
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50183501BDBM50183501(5,6-dihydroxy-2-(3-methyl-2-thienyl)pyrimidine-4-c...)
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50476539BDBM50476539(CHEMBL437708)
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604818BDBM50604818(CHEMBL5188107)
Affinity DataIC50: 1.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604830BDBM50604830(CHEMBL5201304)
Affinity DataIC50: 1.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604834BDBM50604834(CHEMBL5208229)
Affinity DataIC50: 1.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50476518BDBM50476518(CHEMBL277754)
Affinity DataIC50: 1.90E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604812BDBM50604812(CHEMBL4174171)
Affinity DataIC50: 2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604828BDBM50604828(CHEMBL5182790)
Affinity DataIC50: 2.10E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533377BDBM50533377(CHEMBL4475877)
Affinity DataIC50: 2.30E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using dsDNA substrate preincubated for 15 mins followed by substrate addition for 1 hr by ELISAMore data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604831BDBM50604831(CHEMBL5177803)
Affinity DataIC50: 2.40E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604819BDBM50604819(CHEMBL204900)
Affinity DataIC50: 2.50E+3nMAssay Description:Inhibition of recombinant p66/p51 HIV-1 RNase H using 6-FAM-labeld DNA substrate preincubated for 2 mins by fluorescence based assayMore data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetRNA-directed RNA polymerase(Hepatitis C virus genotype 1b (isolate Con1) (HCV))
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50153250BDBM50153250(5,6-Dihydroxy-2-thiophen-2-yl-pyrimidine-4-carboxy...)
Affinity DataIC50: 2.60E+3nMAssay Description:Inhibition of deltaC55 truncated Hepatitis C virus NS5B expressed in Escherichia coli using poly(rA)/oligo(rU) as template/primer incubated for 20 mi...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604815BDBM50604815(CHEMBL1077377)
Affinity DataIC50: 2.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604833BDBM50604833(CHEMBL5187369)
Affinity DataIC50: 2.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604835BDBM50604835(CHEMBL5199493)
Affinity DataIC50: 3.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604816BDBM50604816(CHEMBL5185724)
Affinity DataIC50: 3.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604826BDBM50604826(CHEMBL5200751)
Affinity DataIC50: 3.80E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50571842BDBM50571842(CHEMBL4863466)
Affinity DataIC50: 4.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-C using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcac ssDNA as substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50571842BDBM50571842(CHEMBL4863466)
Affinity DataIC50: 4.20E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50121869BDBM50121869(CHEMBL440562)
Affinity DataIC50: 4.50E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604837BDBM50604837(CHEMBL5194424)
Affinity DataIC50: 5.00E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604825BDBM50604825(CHEMBL5184235)
Affinity DataIC50: 5.70E+3nMAssay Description:Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctg...More data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50571837BDBM50571837(CHEMBL4848335)
Affinity DataIC50: 6.20E+3nMAssay Description:Inhibition of human cytomegalovirus pUL89-CMore data for this Ligand-Target Pair
In Depth
Date in BDB:
6/25/2023
Entry Details
PubMed