| Assay Method Information | |
| | Measurement of Inhibitory Effect Against DGAT2 Enzyme Activity |
| Description: | 1. Preparation of DGAT2 Expression Vector. In order to prepare the pBacPAK9-DGAT2, which is DGAT2 expression vector, the human DGAT2 gene amplified by polymerase chain reaction (PCR) was cloned into the EcoR1 and Xho1 sites of the pBacPAK9 (clonctech) vector. The nucleotide sequence of the primers used in PCR was the forward primer 5′ CTATAAATACGGATCCCGGGAATTCATGGACTACAAGGACGACGATGACAAGCTTAAG ACCCTCATAGCCGCC and the reverse primer 5′ TAAGCGGCCGCCCTGCAGGCCTCGAGTCAGTTCACCTCCAGGAC. The composition of the reaction solution was to contain 50 ng of cDNA clone (OriGene), 200 μM of dATP, dCTP, dTTP, dGTP, 200 nM of each primer, 1 unit of Tag DNA Polymerase (Toyobo), 1x PCR buffer, and the final volume was adjusted to 20 μl. The reaction conditions were denatured at 95° C. for 5 minutes, followed by 30 times of 94° C. for 20 seconds, 60° C. for 20 seconds, and 72° C. for 90 seconds, followed by further reaction at 72° C. for 7 minutes. 2. DGAT2 Expression and Preparation of Membrane Protein. Recombinant human DGAT2 protein was expressed in Sf-21 cells, which are insect cells, by using the BacPack baculovirus expression system (Clontech). The brief manufacturing process is as follows. First, the pBacPAK9-DGAT2 expression vector was transfected with BacPAK6 virus DNA (Bsu36I digest) into sf21 cells using Bacfectin to prepare a recombinant DGAT2 expressing baculovirus. The thus prepared baculovirus was infected with Sf-21 cells at 10 MOI (multiplicity of infection), and after 72 hours, infected insect cells were collected and membrane proteins were isolated. For membrane protein separation, the cell pellet was dissolved in a sucrose solution containing 250 mM sucrose, 10 mM Tris (pH 7.4), and 1 mM ethylenediamine-tetraacetic acid (EDTA), and then homogenized by using a dounce homogenizer, and the supernatant was taken by centrifuging at 600×g for 15 minutes, and centrifuged at 100,000×g for 1 hour to discard the supernatant, and the remaining pellet was resuspended in 20 mM HEPES buffer (pH 7.4). The prepared DGAT2 overexpressing membrane protein was dispensed in 100 μl and stored at −80° C. until use. Protein concentration was quantified by using the BCA Protein Assay Kit (Thermo Scientific). 3. Measurement of Inhibitory Effect Against DGAT2 Enzyme Activity. In vitro DGAT2 analysis was performed using a Phospholipid Flash Plate (PerkinElmer) based on the principle of SPA (Scintilation Proximity Assay). First, DGAT2 inhibition compounds serially diluted 5 times from 3 nM to 10 μM (final concentration, 1% DMSO) were mixed in a buffer solution containing 2 μg DGAT2-membrane protein and 20 mM HEPES, 20 mM MgCl2, 1 mg/mL BSA, 50 μM 1,2 sn-oleoyl glycerol (Sigma), put in a 96-well flash plate (FlashPlate) and reacted at 37° C. for 20 minutes, and then 1 μM [14C] ole oil CoA (PerkinElmer, NEC651050UC) was added to be a final volume of 100 μL and further reacted at 37° C. for 15 minutes. After the enzymatic reaction was completed, 100 μL of isopropanol was added, the plate was sealed with a film, and the plate was shaken slowly in a plate shaker. The next day, the amplified scintillation signal (cpm) in Topcounter (Packard) was measured to measure the degree of production of [14C]-labeled triacyl glycerol (TG) as a reaction product. The measured value when the compound was not treated was used as a positive control, and the measured value of the compound treated group was calculated as a relative % to measure the inhibition effect of the compound on TG production. The IC50 value, which is the concentration of the compound that inhibits TG production by 50%, was determined by treating the response value according to the compound concentration with a nonlinear regression curve using PRISM (Graphpad Inc.). |
| Affinity data for this assay | |
|---|---|
| If you find an error in this entry please send us an E-mail | |