Compile Data Set for Download or QSAR
maximum 50k data
Found 459 with Last Name = 'nagy' and Initial = 'e'
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533361(CHEMBL4451895)
Affinity DataIC50:  100nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533382(CHEMBL4531566)
Affinity DataIC50:  150nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468819(CHEMBL4281296)
Affinity DataIC50:  150nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468792(CHEMBL4280869)
Affinity DataIC50:  150nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533405(CHEMBL4550191)
Affinity DataIC50:  180nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533385(CHEMBL4474029)
Affinity DataIC50:  190nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075207(CHEMBL3414871)
Affinity DataIC50:  200nMAssay Description:Inhibition of HIV1 reverse transcriptase L100I/K103N mutant polymerase activity using [3H]TTP and poly(rA)-oligo(dT)16 substrate incubated for 20 min...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075207(CHEMBL3414871)
Affinity DataIC50:  200nMAssay Description:Inhibition of HIV1 reverse transcriptase Y181C mutant associated RNase H domain activity assessed as reduction in internal cleavage using HTS-1 RNA/D...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468792(CHEMBL4280869)
Affinity DataIC50:  200nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533382(CHEMBL4531566)
Affinity DataIC50:  200nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533361(CHEMBL4451895)
Affinity DataIC50:  200nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468846(CHEMBL4291913)
Affinity DataIC50:  220nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533367(CHEMBL4461191)
Affinity DataIC50:  220nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533386(CHEMBL4466368)
Affinity DataIC50:  240nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533385(CHEMBL4474029)
Affinity DataIC50:  250nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468819(CHEMBL4281296)
Affinity DataIC50:  250nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468792(CHEMBL4280869)
Affinity DataIC50:  250nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468792(CHEMBL4280869)
Affinity DataIC50:  250nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075207(CHEMBL3414871)
Affinity DataIC50:  300nMAssay Description:Inhibition of HIV1 reverse transcriptase L100I/K103N mutant associated RNase H domain activity assessed as reduction in reduction in DNA 3' end direc...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075204(CHEMBL3414868)
Affinity DataIC50:  300nMAssay Description:Inhibition of HIV1 reverse transcriptase L100I/K103N mutant polymerase activity using [3H]TTP and poly(rA)-oligo(dT)16 substrate incubated for 20 min...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075207(CHEMBL3414871)
Affinity DataIC50:  300nMAssay Description:Inhibition of HIV1 reverse transcriptase Y181C mutant associated RNase H domain activity assessed as reduction in reduction in DNA 3' end directed cl...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075207(CHEMBL3414871)
Affinity DataIC50:  300nMAssay Description:Inhibition of HIV1 reverse transcriptase Y181C mutant polymerase activity using [3H]TTP and poly(rA)-oligo(dT)16 substrate incubated for 20 mins by l...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533382(CHEMBL4531566)
Affinity DataIC50:  300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533382(CHEMBL4531566)
Affinity DataIC50:  300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468819(CHEMBL4281296)
Affinity DataIC50:  300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468819(CHEMBL4281296)
Affinity DataIC50:  300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533361(CHEMBL4451895)
Affinity DataIC50:  300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533377(CHEMBL4475877)
Affinity DataIC50:  310nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533385(CHEMBL4474029)
Affinity DataIC50:  320nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533385(CHEMBL4474029)
Affinity DataIC50:  340nMAssay Description:Inhibition of polymerase activity of HIV1 reverse transcriptase using poly(rA)-oligo(dT)16 and [3H]-TTP incubated for 20 mins by liquid scintillation...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533405(CHEMBL4550191)
Affinity DataIC50:  370nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468846(CHEMBL4291913)
Affinity DataIC50:  370nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533376(CHEMBL4453169)
Affinity DataIC50:  380nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075207(CHEMBL3414871)
Affinity DataIC50:  400nMAssay Description:Inhibition of HIV1 recombinant reverse transcriptase associated catalytically active RNase H domain assessed as reduction in internal cleavage using ...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075207(CHEMBL3414871)
Affinity DataIC50:  400nMAssay Description:Inhibition of reconstituted HIV1 RNase H using RNA/DNA duplex substrate by fluorescence assayMore data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50075207(CHEMBL3414871)
Affinity DataIC50:  400nMAssay Description:Inhibition of HIV1 reverse transcriptase L100I/K103N mutant associated RNase H domain activity assessed as reduction in internal cleavage using HTS-1...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetIntegrase(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM23399(4-{1-[(4-fluorophenyl)methyl]-1H-pyrrol-2-yl}-2,4-...)
Affinity DataIC50:  400nMAssay Description:Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-C...More data for this Ligand-Target Pair
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533353(CHEMBL4549947)
Affinity DataIC50:  400nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533392(CHEMBL4529253)
Affinity DataIC50:  400nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533361(CHEMBL4451895)
Affinity DataIC50:  400nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533353(CHEMBL4549947)
Affinity DataIC50:  400nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533367(CHEMBL4461191)
Affinity DataIC50:  400nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533367(CHEMBL4461191)
Affinity DataIC50:  430nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533376(CHEMBL4453169)
Affinity DataIC50:  440nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50468846(CHEMBL4291913)
Affinity DataIC50:  450nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533376(CHEMBL4453169)
Affinity DataIC50:  450nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533405(CHEMBL4550191)
Affinity DataIC50:  450nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533386(CHEMBL4466368)
Affinity DataIC50:  460nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533354(CHEMBL4455962)
Affinity DataIC50:  470nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus 1)
University Of Minnesota

Curated by ChEMBL
LigandPNGBDBM50533372(CHEMBL4454510)
Affinity DataIC50:  470nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
Ligand InfoPC cidPC sid
In DepthDetails ArticlePubMed
Displayed 1 to 50 (of 459 total ) | Next | Last >>
Jump to: