Report error Found 58 Enz. Inhib. hit(s) with all data for entry = 50020829
Affinity DataIC50: 10nMAssay Description:Inhibition of HIV-1 integrase DTG-resistant R263K mutantMore data for this Ligand-Target Pair
Affinity DataIC50: 10nMAssay Description:Inhibition of HIV-1 integrase DTG-resistant R263K mutantMore data for this Ligand-Target Pair
Affinity DataIC50: 15nMAssay Description:Inhibition of HIV-1 integrase strand transfer activityMore data for this Ligand-Target Pair
Affinity DataIC50: 15nMAssay Description:Inhibition of HIV-1 integrase G140S/Q148K double mutantMore data for this Ligand-Target Pair
Affinity DataIC50: 33nMAssay Description:Inhibition of HIV-1 integrase DTG-resistant R263K mutantMore data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 40nMAssay Description:Inhibition of HIV-1 reverse transcriptaseMore data for this Ligand-Target Pair
Affinity DataIC50: 100nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 220nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 300nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 400nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 480nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 600nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 600nMAssay Description:Inhibition of HIV-1 integrase DTG-resistant R263K mutantMore data for this Ligand-Target Pair
Affinity DataIC50: 620nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 680nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 740nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 790nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 940nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.00E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.60E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.80E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 2.20E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
TargetRNA-directed RNA polymerase(Hepatitis C virus genotype 1b (isolate Con1) (HCV))
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.25E+3nMAssay Description:Inhibition of Hepatitis C virus NS5B polymeraseMore data for this Ligand-Target Pair
Affinity DataIC50: 2.30E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 2.40E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.50E+3nMAssay Description:Inhibition of HIV-1 RNase H polymerase activityMore data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.50E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase RNase HMore data for this Ligand-Target Pair
TargetRNA-directed RNA polymerase(Hepatitis C virus genotype 1b (isolate Con1) (HCV))
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 2.60E+3nMAssay Description:Inhibition of Hepatitis C virus NS5B polymeraseMore data for this Ligand-Target Pair
Affinity DataIC50: 2.60E+3nMAssay Description:Inhibition of HIV-1 integrase G140S/Q148K double mutantMore data for this Ligand-Target Pair
Affinity DataIC50: 2.80E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 2.90E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 4.50E+3nMAssay Description:Inhibition of human Cytomegalovirus C-terminal UL89More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 5.40E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymeraseMore data for this Ligand-Target Pair
TargetRNA-directed RNA polymerase(Hepatitis C virus genotype 1b (isolate Con1) (HCV))
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 5.70E+3nMAssay Description:Inhibition of Hepatitis C virus NS5B polymeraseMore data for this Ligand-Target Pair
Affinity DataIC50: 6.00E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 6.20E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 6.40E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 8.00E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 9.30E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.40E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.40E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.40E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair














































